Information

Acknowledging differentiation of species, in historical times


This is at least partly an historical question, and I am not even remotely a biologist of any sort, so apologies beforehand if it's a little obscure.

I often wonder how many distinctions were made in pre-Renaissance times, between species of animals.

For example, though I'm sure there have always been those with enough of an interest in nature to tell subtle differences, how were lemmings or voles, for example, told apart from rats or mice? Or did this recognition of speciation only come later, once more detailed (intrusive) forms of analysis became common?

I've looked up the etymologies for vole, lemming and hamster and all are dated post-Renaissance, so at least in these instances it may be safe to assume that people might simply not have noticed the differences before closer study took place. But I guess there are other animals where the same question applies (particularly smaller, harder-to-scrutinise animals where there are a large number of species similar at a glance).

EDIT: Vole means field (same root as wold), giving rise to the 19th c. term volemouse, meaning that originally, mouse and vole were indeed seen as one and the same -- proof of point.

P.S. Of course, this question need not apply solely to animal species.


The branch of science you are looking for is taxonomy, that is the science of identifying and naming species, and arranging them into a classification.

Modern taxonomy was born from the studies of the Swedish zoologist Carl Linnæus (1707-1778), who first introduced, in his books Systema Naturae (Systems of Nature) and Species Plantarum (Plants Species) the now common binomial nomenclature where each different species is given a Latin name composed by two parts: one identifying the genus and one identifying the species.

For instance, various species of mice are in the genus Mus: the common house mouse is Mus musculus, but in the West Mediterranean you have another type of mouse, called Mus spretus.

Although this rigorous type of classification is quite recent, taxonomy existed much earlier.

Shennong, Emperor of China somewhere around 4000BC apparently tasted hundred of plants to test their curative properties. He wrote his observations in a book called the Shennong Ben Cao Jing.

On a similar note the Ebers Papyrus, dating ~1550 BC contains description of the properties of many plants.

To more "recent" times, around 300BC Aristotle was the first who actually classified animals (e.g. vertebrates and invertebrates) and his student Theophrastus wrote a classification of plants in his Historia Plantarum (Hystory of the Plants).

Some 400 years later Plinius in the Naturalis Historia (Natural History) enumerated many plants and animals and gave some of the first binomial names to certain species.

As to the point of how did they distinguish species: well, with their eyes and ears, of course! You can distinguish a mouse from a vole because it is skinnier and has a longer tail. Even more similar species can be easily distinguished without needing special equipment. A good birdwatcher can distinguish a chiffchaff from a willow warbler by listening to their songs, looking at how they behave how they fly, the subtly different tones of their feathers etc. We can do that now, without any special equipment, so they could before the Renaissance!


If I understand John S. Wilkins' magnificent book on the history of the "species" concept correctly, the basis of biological taxonomy can be traced back to the Aristotelian idea of per genus et differentiam: you can define something as consisting of a general type ("a plant") with a difference ("made of wood") to define an entity ("a tree"), which could then itself become the general type for a more specific category ("an oak tree"). So the idea of an infimae species (an entity that cannot be split any further) has been around since antiquity.

Whether or not a specific group of people would have split similar-looking species is a bigger unknown. I can't find a good online reference for Aristotle's classification of living things; you can read a summary on Wikipedia. Sorry I can't be more helpful!


Unifying Species Diversity, Phylogenetic Diversity, Functional Diversity, and Related Similarity and Differentiation Measures Through Hill Numbers

Hill numbers or the effective number of species are increasingly used to quantify species diversity of an assemblage. Hill numbers were recently extended to phylogenetic diversity, which incorporates species evolutionary history, as well as to functional diversity, which considers the differences among species traits. We review these extensions and integrate them into a framework of attribute diversity (the effective number of entities or total attribute value) based on Hill numbers of taxonomic entities (species), phylogenetic entities (branches of unit-length), or functional entities (species-pairs with unit-distance between species). This framework unifies ecologists' measures of species diversity, phylogenetic diversity, and distance-based functional diversity. It also provides a unified method of decomposing these diversities and constructing normalized taxonomic, phylogenetic, and functional similarity and differentiation measures, including N-assemblage phylogenetic or functional generalizations of the classic Jaccard, Sørensen, Horn, and Morisita-Horn indexes. A real example shows how this framework extracts ecological meaning from complex data.


Abstract

As populations diverge, genetic differences accumulate across the genome. Spurred by rapid developments in sequencing technology, genome-wide population surveys of natural populations promise insights into the evolutionary processes and the genetic basis underlying speciation. Although genomic regions of elevated differentiation are the focus of searches for 'speciation genes', there is an increasing realization that such genomic signatures can also arise by alternative processes that are not related to population divergence, such as linked selection. In this Review, we explore methodological trends in speciation genomic studies, highlight the difficulty in separating processes related to speciation from those emerging from genome-wide properties that are not related to reproductive isolation, and provide a set of suggestions for future work in this area.


Differentiation of vegetation zones and species strategies in the subalpine region of Mt. Fuji

The floristic and structural differentiation of vegetation along the altitudinal gradient in four subalpine forests of different developmental stages on Mt. Fuji has been studied. Near the forest limit a micropattern of vegetation corresponding to the altitudinal zonation has been observed which elucidated the mechanisms of development of the vegetation zonation.

As to early stages of vegetation development only two types can be distinguished: the volcanic desert above 1500 m and the pioneer forests below. As to later stages a differentiation of subzones includes from higher to lower altitudes: the Alnus maximowiczii, Betula ermanii, Abies veitchii and Tsuga diversifolia forests. Larix leptolepis and Sorbus americana ssp. japonica, appear as co-dominants in ecotonal communities between the principal subzones and are also important pioneers in early stages. Similarity analyses reveal that the upper subalpine Alnus-Betula forests can be regarded as early successional phases of the climax Abies-Tsuga forests of the lower subalpine zone.

The regular arrangement of A. maximowiczii-B. ermanii-A. veitchii is studied along the gradient from the margin to the interior of the forest growing near the forest limit where locally favourable conditions prevail. Growth form, height growth, photosynthetic activity, seed supply, and seedling distribution of the three principal species have been compared, as well as biomass and production relations in contiguous forests of these species. The marginal Alnus type community is productive and disturbance-tolerant, and has a wide ecological and sociological amplitude along the gradient, while the central Abies community is accumulative and disturbance-intolerant, and has a narrower tolerance range, but is superior in competition under stable habitat conditions. A vegetation organization, ‘temporal multi-storeyed structure’, is suggested which means that a zonal pattern of vegetation within a climax region develops by successive replacement of successional species along an environmental gradient.


Plan of Research:

In this thesis, I will compare the cranial anatomy of A. cacatuoides to that of “Cichlasoma” (Archocentrus) nigrofasciatum, a commonly bred fish reared by aquarists known as the Convict Cichlid, a “typical” medium-sized cichlid also of South American origin. The Convicts will be examined at various stages in development, from juvenile to adult, and will be compared to A.cacatuoides.

The first part of this project will involve whole mount preparation of A. cacatuoides, utilizing the staining and clearing procedures described by Taylor and Van Dyke, 1985. This procedure involves the use of Alizarin Red and Alcian Blue to stain bone and cartilage, and takes into account the adaptations and recommendations Proposed in an earlier paper (Hanken and Wassersug 1981). The Taylor and Van Dyke procedure is specifically for the staining and clearing of small fish and other vertebrates. I tested the procedure during last semester¹s Independent Study and made a few minor adjustments to the protocol.

First, the specimens will be placed serially into an absolute ethyl alcohol solution and stained with Alcian Blue. The fish will then be neutralized in a saturated borax solution, transferred to a 20% hydrogen peroxide solution in potassium hydroxide, and then bleached under a fluorescent light. The unwanted soft tissues will then be cleared using trypsin powder, and then stained in KOH again with alizarin red. The final preparation of the fish involves rinsing the fish, and placing them serially into 40%, 70%, and finally 100% glycerin.

Following the above preparation of the specimens, the crania of the A. cacatuoides specimens will be examined for morphological variation and compared to the cranial anatomy of the Convict cichlid as a progenitor reference point examined at various developmental stages to see if paedomorphosis in indeed the mechanism of miniaturization in A. cacatuoides.


Journal list menu

Department of Ecology and Evolutionary Biology, University of Toronto, Toronto, Ontario, M5S 3B2 Canada

Department of Biological Sciences, University of Toronto Scarborough, Toronto, Ontario, M1C 1A4 Canada

Department of Ecology and Evolutionary Biology, University of Toronto, Toronto, Ontario, M5S 3B2 Canada

Department of Biological Sciences, University of Toronto Scarborough, Toronto, Ontario, M1C 1A4 Canada

Department of Ecology and Evolutionary Biology, University of Toronto, Toronto, Ontario, M5S 3B2 Canada

Department of Biological Sciences, University of Toronto Scarborough, Toronto, Ontario, M1C 1A4 Canada

Department of Ecology and Evolutionary Biology, University of Toronto, Toronto, Ontario, M5S 3B2 Canada

Department of Biological Sciences, University of Toronto Scarborough, Toronto, Ontario, M1C 1A4 Canada

Corresponding Editor: Helmut Hillebrand.

Abstract

The addition of nonnative species and loss of native species has modified the composition of communities globally. Although changes in β-diversity have been well documented, there is a need for studies incorporating multiple time periods, more than one dimension of biodiversity, and inclusion of nestedness and turnover components to understand the underlying mechanisms structuring community composition and assembly. Here, we examined temporal changes in functional dissimilarity of fish communities of the Laurentian Great Lakes and compared these changes to those of taxonomic dissimilarity by decade from 1870 to 2010. Jaccard-derived functional dissimilarity index was used to quantify changes in functional β-diversity within communities, between all possible pairs of communities, and using a multiple-site index among all communities. β-diversity was partitioned into components of nestedness and turnover, and changes were examined over time. Similar to patterns in taxonomic dissimilarity, each community functionally differentiated from the historical community of 1870, with Lake Superior changing the most (

24%) and Lake Ontario the least (

14%). Although communities have become taxonomically homogenized, functional β-diversity among all communities has increased over time, indicating functional differentiation. This is likely due to functional similarity between the communities being historically high (i.e.,

88% similar in 1870). The higher taxonomic relative to functional turnover indicates that the species being replaced between communities are functionally redundant, which could occur given the harsh environmental conditions of the region and/or as a result of the recent glacial history of the region. High functional nestedness across communities reflects dispersal limitations, with smaller communities being functional subsets of large communities closer to source populations. The functional differentiation observed is likely due to nonnative species with functional traits unique to the region establishing or the loss of functionally redundant native species however, it is important to note that patterns of homogenization were periodically observed through time. Our study demonstrates the possible factors regulating diversity in the Laurentian Great Lakes fish communities, that patterns of taxonomic and functional β-diversity are dynamic over time and vary in the magnitude and direction of change, and that taxonomic diversity should not be used to predict changes in functional diversity.

Please note: The publisher is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.


Methods

Gill tissue from the second known coelacanth captured off Manado Tua [MZB10003 Coelacanth Conservation Council (CCC) no. 175] was preserved in ethanol immediately after death. DNA was obtained by digestion of the sample with proteinase K in sodium chloride/Tris⿭TA and 1% SDS. The lysate was purified by two extractions with phenol and chloroform followed by two extractions with chloroform. Extracted DNA was precipitated by using NaCl and ethanol. DNA was resuspended in distilled water. DNA fragments were PCR-amplified from genomic DNA by using the primers shown in Table ​ Table1. 1 .

Table 1

The pairs of primers used to amplify and sequence the coelacanth mitochondrial DNA

NameLocationSequence
MVZ0514,293�,320CGAAGCTTGATATGAAAAACCATCGTTG
LcProR15,534�,508AATAGTTTAATTAGAATTTTAGCTTTGGGAGC
LCCYTB2.514,768�,787GGCAACCGTCATCACAAAC
LCCYTB2.315,332�,313TGCTACAAGGGCTCAGAATA
mt114815,411�,436ACCTACTTCAGCCTATTCCTCATCCT
mt170415,966�,943TAAAAAGCCCTTCCCCTCACTAAA
mt166215,925�,949CTGGCATCTGGTTTTGGGTTTAGTG
mt2387240�CCTTGGGGGTGTGGCTGGAC
12SH70�AAAGGTTTGGTCCTAGCCTT
12eR821�AGAAAATGTAGCCCATTTCTTCCC
12Sa507�AAACTGGGATTAGTATCCCCACTAT
16SH1,342𠄱,321GCTAGACCATKATGCAAAAGGTA
mt32451,098𠄱,115CCACGAAAGCGGGTCATT
mt41101,963𠄱,941ATCTTTCGTGGTTGCATTCCTGT
16SC1,668𠄱,686TAUGGCCTAAAAGCTGCCAC
16SDR2,631𠄲,606CTCCGGTCTGAACTCAGATCACGTAG
mt44612,315𠄲,338ACTGGCCCTATTGTCTTTGGTTGG
mt49192,771𠄲,746TACGGGAGCGGTTGTGTTCTTCTTTA

The location of the primer indicates the number of the first and last base of the primer when aligned to the sequence of Zardoya and Meyer (11). All sequences are given 5′ to 3′. 

PCR products were cleaned by using WizardPreps (Promega), and cycle-sequencing reactions were performed by using Applied Biosystems rhodamine dye-terminated nucleotides. Unused dyes and primers were removed by passing the sample through Sephadex G50 columns. Sequencing reactions were analyzed on an Applied Biosystems Prism 377 Automated Sequencer. Sequences from the Indonesian coelacanth were compared with the published sequence (11) of the entire mitochondrial genome of an African coelacanth (GenBank accession no. <"type":"entrez-nucleotide","attrs":<"text":"U82228","term_id":"1916817">> U82228, CCC no. 138). Sequences were aligned by eye.


Availability of data and materials

The raw reads including whole-genome resequencing and RNA sequencing in this study are publicly available at the NCBI Sequence Read Archive under accession code PRJNA476679 [66]. The sequence reads of Chinese Spring (CS) and an Ae. tauschii accession (A1) analyzed during the study were reported previously [19,20,21]. The NCBI accessions are PRJNA329335 (SRR5170323, SRR5184282, and SRR5184283) and PRJNA392179 (SRR5815659, SRR5817288, SRR5817289, and SRR5817290), respectively. The sequence reads of 16 download variety accessions are available from the website https://downloads-qcif.bioplatforms.com/bpa/wheat_cultivars/cultivars/.

The exome capture data of landrace accessions were downloaded from NCBI Short Read Archive (SRP032974). The exome capture SNP dataset in the VCF format for wild and domesticated emmer is available from the website https://www.dropbox.com/sh/3dm05grokhl0nbv/AABe6yrr2FVXdFasJUYEW12ca/Allelic%20diversity?dl=0&preview=all_emmer_filtered_variants_header_to_SAMN04448013.vcf.


Acknowledging differentiation of species, in historical times - Biology

a Department of Chemistry, University of Illinois at Chicago, Chicago, IL 60607-7061, USA
E-mail: [email protected]

b Chemical Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, CA 94720, USA

c Center for Biofilm Engineering, Montana State University, Bozeman, MT 59717, USA

Abstract

7.87 to 10.5 eV vacuum ultraviolet (VUV) photon energies were used in laser desorption postionization mass spectrometry (LDPI-MS) to analyze biofilms comprised of binary cultures of interacting microorganisms. The effect of photon energy was examined using both tunable synchrotron and laser sources of VUV radiation. Principal components analysis (PCA) was applied to the MS data to differentiate species in Escherichia coliSaccharomyces cerevisiae coculture biofilms. PCA of LDPI-MS also differentiated individual E. coli strains in a biofilm comprised of two interacting gene deletion strains, even though these strains differed from the wild type K-12 strain by no more than four gene deletions each out of approximately 2000 genes. PCA treatment of 7.87 eV LDPI-MS data separated the E. coli strains into three distinct groups, two “pure” groups, and a mixed region. Furthermore, the “pure” regions of the E. coli cocultures showed greater variance by PCA at 7.87 eV photon energies compared to 10.5 eV radiation. This is consistent with the expectation that the 7.87 eV photoionization selects a subset of low ionization energy analytes while 10.5 eV is more inclusive, detecting a wider range of analytes. These two VUV photon energies therefore give different spreads via PCA and their respective use in LDPI-MS constitute an additional experimental parameter to differentiate strains and species.


Methods

A full description of methods is given in Additional file 1.

Sampling

We sampled all traditionally recognized taxa in the Pitta sordida species complex [9, 11, 14, 19,20,21,22] (Fig. 1 Additional file 2: Tables S11-S12) across its entire distribution, from Nepal to eastern New Guinea. For the sake of convenience, we herein follow the taxonomy of Erritzoe & Erritzoe [11] who recognized one species, Pitta sordida, with 13 subspecies. Although all these subspecies were sampled, we include goodfellowi and hebetior within novaeguineae in the discussion of the populations in New Guinea if not explicitly stated otherwise. The rationale for this is that these three subspecies were found to be genetically inseparable in our analyses.

Sequencing, reference mapping and variant calling

We de novo sequenced a sample of an individual of Pitta sordida cucullata found freshly dead in Bukit Batok Nature Park in Singapore after collision with a window. It was assigned to the migratory subspecies cucullata based on its brown crown. The resident Sundaic subspecies mulleri, which has a black crown, is not yet known from Singapore. Tissue aliquots of the specimens were deposited at the Lee Kong Chian Natural History Museum (Singapore). For another 28 individuals we extracted DNA from toe-pads sampled from museum study skins (Additional file 2: Table S12). An Illumina HiSeqX platform at the National Genomics Institute in Stockholm was used both for de novo sequencing and whole-genome resequencing. Reads were processed using a custom designed, clean-up workflow that is available at https://github.com/mozesblom. We mapped the reads against several references to construct data sets of different characteristics for phylogenetic analyses, e.g., fast evolving mitochondrial genes and more slowly evolving nuclear genes (Additional file 2: Table S1). As expected, mapping coverage varied considerably among data sets and individuals (Additional file 2: Table S13). The mitochondrial genome had a mean mapping coverage of 998x while mapping to the de novo genome obtained in this study gave a mean coverage of 5.7x. SNPs were called from the genome BAM-files using two different workflows (Samtools and GATK), but for analyses we used only those variants that were identified by both workflows (see Additional file 1 for a more detailed description of the initial bioinformatics).

Phylogenetic analyses and population genetic structure

We estimated best-fit maximum-likelihood trees with RAxML [23] both individually for each of the 23 nuclear genes and the mitochondrial genome, for the concatenated data sets consisting of all 23 nuclear genes for which taxon-complete alignments were available, and for this latter data set combined with the mitochondrial data set (totaling 41,907 bp before filtering) (see Additional file 2: Table S1 for more details). We estimated phylogenetic relationships from SNP data using a neighbor-joining algorithm in TreeBest [24]. We also used SNPs to infer population genetic structure both by principal component analyses using smartpca in EIGENSOFT v. 6.1.4 [25] and with the clustering algorithms FRAPPE v. 1.1 [26] and ADMIXTURE v. 1.3 [27]. The degree to which genetic differentiation can be explained by geographic distance between sampling localities was assessed by plotting the genomic distance (p-distances) between each pair of individuals against their geographic distance.

Demographic history and genetic admixture

Demographic history of the Pitta sordida species complex, including population divergence times, ancestral population size and migration rates, was inferred using the Generalized Phylogenetic Coalescent Sampler (G-PhoCS) [28] and a data set consisting of 1,569 segments of 202 bp each. The data were derived from McCormack et al. [29] who obtained a total of 316 kb of nucleotides from the flanking regions of 1,572 different UCE (ultra-conserved elements) loci distributed across the genome of the banded pitta Pitta guajana. The flanking regions around the UCEs are characterized by having a high variability and evolving neutrally [30]. We downloaded the concatenated data set from the Dryad data package [31] and used it as a mapping reference. After alignment we arbitrarily divided the data set into 1,569 segments consisting of 202 bp each. Burn-in and convergence of each run in G-PhoCS were determined with TRACER v. 1.7 [32]. We repeated the analysis with six separate runs to obtain reliable and stable estimates for the demographic parameters. Posterior distributions of τ (coalescent branch lengths) and θ (ancestral scaled population sizes) were re-calculated to divergence times in units of years, effective population sizes, and migration rates by scaling with a neutral mutation rate of 4.6*10 − 9 [33] and a generation time of 4.2 years [34]. The amount of gene flow was estimated from the mean number of migrants per generation (Ms-t) for the migration bands inferred by G-PhoCS using the predefined tree topology in Fig. 2 (after pruning palawanensis from the tree, see text in Additional file 1 for details).


Watch the video: Calculus 1 Lecture: Techniques of Differentiation Finding Derivatives of Functions Easily (December 2021).